| ROUGE |
Gene/Protein Characteristic Table for mKIAA4172 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK004540 |
|---|---|
| Arylsulfatase A precursor. | |
| mbj00115 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2630 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 740 bp Genome contig ID gi65543215r_89425400 PolyA signal sequence
(AATAAA,-8) +----*----+----*----+----*----+----
TTTCTACAAAAAAAAATAATAAAAATAAATAAAATFlanking genome sequence
(99972 - 99923) ----+----*----+----*----+----*----+----*----+----*
AAAATAAAGTTGTCTACAAAGTAATCTTTTAGAAGCATCTATCAGGGGCC
Features of the protein sequence |
Description | |
Coding region: 343..1887
Length: 515 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |