ROUGE

Gene/Protein Characteristic Table for mKIAA0990

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129255
Description :
Clone Name :	mpg00916 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4167 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1368 bp

Genome contig ID gi65511124f_59893740
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
AACAAATAAACCAGTGGACAGTATTTTTCTATTGT
Flanking genome sequence
(164275 - 164324)
----+----*----+----*----+----*----+----*----+----*
ACTCTGCAGACCCATTTTGTCTCATTATTTGTGTTGGTTGAAGACTTGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0990 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0990	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 334..2799
Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6ZQ11	100.0	Chondroitin sul...	Mus musculus
EDM08427	98.1	carbohydrate (c...	Rattus norvegicus
XP_545821	93.5	similar to carb...	Canis lupus fam...
Q86X52	94.4	Chondroitin sul...	Homo sapiens
AAQ88893	94.3	CHSY1 [Homo sap...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220519	4.1e-193	61.9	mKIAA4168
AK122504	3.4e-21	26.0	mKIAA1402

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008428 258 797 PF05679 Chondroitin N-acetylgalactosaminyltransferase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008428	258	797	PF05679	Chondroitin N-acetylgalactosaminyltransferase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 30 52 WLSMLLGLVLGFVLASRLVLPRA

Method	From	To	amino acid sequence
SOSUI	30	52	WLSMLLGLVLGFVLASRLVLPRA

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1368 bp
Genome contig ID	gi65511124f_59893740
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- AACAAATAAACCAGTGGACAGTATTTTTCTATTGT
Flanking genome sequence (164275 - 164324)	----+--------+--------+--------+--------+----* ACTCTGCAGACCCATTTTGTCTCATTATTTGTGTTGGTTGAAGACTTGAG

Gene/Protein Characteristic Table for mKIAA0990

Features of the cloned DNA sequence

Features of the protein sequence