Order Kazusa clone(s) from : ![]() |
Product ID | ORK01620 |
---|---|
Accession No | AB023207 |
Description | chondroitin sulfate synthase 1 |
Clone name | hk05454 |
Vector information | |
cDNA sequence | DNA sequence (4565 bp) Predicted protein sequence (883 aa) |
HaloTag ORF Clone |
FHC01620
![]() |
Flexi ORF Clone | FXC01620 |
Source | Human adult brain |
Rouge ID |
mKIAA0990
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1662 bp |
---|---|
Genome contig ID | gi51511731r_99433456 |
PolyA signal sequence (AGTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 99533456 | 99609660 | 3 | 98.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR008428 | 319 | 858 | PF05679 | Chondroitin N-acetylgalactosaminyltransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 90 | WLSVLLGLVLGFVLASRLVLPRA | 112 | PRIMARY | 23 |
---|
![]() |
Primer_f | GTTGTCCAGGCAGGTTTGAAG |
---|---|
Primer_r | AGCTGCTGTGTGGACCCATAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |