ROUGE

Gene/Protein Characteristic Table for mKIAA0989

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC035201
Description :	angiomotin like 2. Leman coiled-coil protein. angiomotin-like protein 2.
Clone Name :	mpm12317 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4180 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1711 bp

Genome contig ID gi65519420f_102571009
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ATGACAGTATTTTAATAAAAAAAGAGCTTATAAGG
Flanking genome sequence
(113061 - 113110)
----+----*----+----*----+----*----+----*----+----*
AGATGTCTGTCTGTCTGTCTATTGGTTGAGACACAACCTAGGTTTGAGCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0989 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0989	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 46..2469
Length: 807 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAX15834	0	100.0	angiomotin like...	Mus musculus
Q8K371	0	100.0	Angiomotin-like...	Mus musculus
EDL77397	3.8e-205	95.6	angiomotin like...	Rattus norvegicus
BAE37932	4.1e-194	99.9	unnamed protein...	Mus musculus
XP_001112164	2.4e-192	86.8	similar to angi...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220238	5.9e-28	42.5	mFLJ00155
AK129277	1.1e-13	46.2	mKIAA1071

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 230 331 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	230	331	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1711 bp
Genome contig ID	gi65519420f_102571009
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATGACAGTATTTTAATAAAAAAAGAGCTTATAAGG
Flanking genome sequence (113061 - 113110)	----+--------+--------+--------+--------+----* AGATGTCTGTCTGTCTGTCTATTGGTTGAGACACAACCTAGGTTTGAGCC

Gene/Protein Characteristic Table for mKIAA0989

Features of the cloned DNA sequence

Features of the protein sequence