ROUGE |
Gene/Protein Characteristic Table for mKIAA1071 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129277 |
---|---|
angiomotin. | |
mpm04376 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5197 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3576 bp Genome contig ID gi66880665r_138786472 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
CCTATCTTTCAATAAAGTTAGCCATTTTAAAATGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCACTGTGTGGAAAATGCTTTGGTGTTTACTGGCTTTGTGTGATGTTAA
KIAA Alignment based on: KIAA1071 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1621
Length: 539 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000104 | 308 | 322 | PR00308 | Antifreeze protein |
IPR000104 | 322 | 333 | PR00308 | Antifreeze protein | |
IPR000104 | 333 | 342 | PR00308 | Antifreeze protein | |
ProfileScan | NULL | 268 | 452 | PS50310 | NULL |
IPR000694 | 430 | 510 | PS50099 | Proline-rich region |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |