| ROUGE |
Gene/Protein Characteristic Table for mKIAA0989 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | BC035201 |
|---|---|
| angiomotin like 2. Leman coiled-coil protein. angiomotin-like protein 2. |
|
| mpm12317 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4180 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1711 bp Genome contig ID gi65519420f_102571009 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
ATGACAGTATTTTAATAAAAAAAGAGCTTATAAGGFlanking genome sequence
(113061 - 113110) ----+----*----+----*----+----*----+----*----+----*
AGATGTCTGTCTGTCTGTCTATTGGTTGAGACACAACCTAGGTTTGAGCC
KIAA Alignment based on: KIAA0989 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 46..2469
Length: 807 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |