ROUGE |
Gene/Protein Characteristic Table for mKIAA1306 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129327 |
---|---|
CASK interacting protein 1. | |
mbg04314 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5498 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1452 bp Genome contig ID gi65550231f_22192593 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
GAGCTGCTGTCAGCTGTCAATAAACAGCAGAAAACFlanking genome sequence
(119663 - 119712) ----+----*----+----*----+----*----+----*----+----*
AGAGCTGCTTGGCTCACACTCTTTGGGGGTGTGGGGGGGAGGGGGGTAAT
KIAA Alignment based on: KIAA1306 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..4046
Length: 1347 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 176 | 188 | PR01415 | Ankyrin |
IPR002110 | 188 | 200 | PR01415 | Ankyrin | |
IPR003993 | 1190 | 1208 | PR01503 | Treacher Collins syndrome protein Treacle | |
IPR003993 | 1226 | 1249 | PR01503 | Treacher Collins syndrome protein Treacle | |
HMMPfam | IPR002110 | 35 | 67 | PF00023 | Ankyrin |
IPR002110 | 68 | 100 | PF00023 | Ankyrin | |
IPR002110 | 101 | 133 | PF00023 | Ankyrin | |
IPR002110 | 134 | 164 | PF00023 | Ankyrin | |
IPR002110 | 175 | 207 | PF00023 | Ankyrin | |
IPR002110 | 210 | 239 | PF00023 | Ankyrin | |
IPR001452 | 271 | 332 | PF00018 | SH3 | |
IPR011511 | 272 | 332 | PF07653 | Variant SH3 | |
IPR001660 | 459 | 523 | PF00536 | Sterile alpha motif SAM | |
IPR011510 | 460 | 525 | PF07647 | Sterile alpha motif homology 2 | |
HMMSmart | IPR002110 | 35 | 64 | SM00248 | Ankyrin |
IPR002110 | 68 | 97 | SM00248 | Ankyrin | |
IPR002110 | 101 | 130 | SM00248 | Ankyrin | |
IPR002110 | 134 | 163 | SM00248 | Ankyrin | |
IPR002110 | 175 | 204 | SM00248 | Ankyrin | |
IPR002110 | 207 | 236 | SM00248 | Ankyrin | |
IPR001452 | 271 | 333 | SM00326 | SH3 | |
IPR001660 | 458 | 525 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR002110 | 28 | 276 | PS50297 | Ankyrin |
IPR002110 | 35 | 67 | PS50088 | Ankyrin | |
IPR002110 | 68 | 100 | PS50088 | Ankyrin | |
IPR002110 | 101 | 133 | PS50088 | Ankyrin | |
IPR002110 | 134 | 158 | PS50088 | Ankyrin | |
IPR002110 | 175 | 207 | PS50088 | Ankyrin | |
IPR002110 | 207 | 239 | PS50088 | Ankyrin | |
IPR001452 | 268 | 334 | PS50002 | SH3 | |
IPR001660 | 465 | 525 | PS50105 | Sterile alpha motif SAM | |
IPR000694 | 677 | 794 | PS50099 | Proline-rich region | |
IPR000694 | 1070 | 1272 | PS50099 | Proline-rich region |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |