ROUGE |
Gene/Protein Characteristic Table for mKIAA0943 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129242 |
---|---|
autophagin 1. AUT-like 1, cysteine endopeptidase (S. cerevisiae). cysteine protease involved in autophagy APG4-B. |
|
mbh04274 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4185 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 419 bp Genome contig ID gi65488608f_93497867 PolyA signal sequence
(ATTAAA,-25) +----*----+----*----+----*----+----
TTTATTTGGAATTAAAGCCCTGTTTGAAGTTGTTTFlanking genome sequence
(120438 - 120487) ----+----*----+----*----+----*----+----*----+----*
AACAAAGACATGAATTTCTGGGGCACTTCCCAGGTCAGTCTTAGACGATC
KIAA Alignment based on: KIAA0943 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2966..3766
Length: 266 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |