ROUGE |
Gene/Protein Characteristic Table for mKIAA0886 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220511 |
---|---|
Reticulon 4. | |
mfj56082 [Vector Info] | |
Source : | Mouse fetal brain |
Note : | This cDNA was previously called as mKIAA4153. |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4648 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 908 bp Genome contig ID gi65527427f_29487738 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CTGTAAAGCAAAGTATCAATAAAGCTTATAGACTTFlanking genome sequence
(149970 - 150019) ----+----*----+----*----+----*----+----*----+----*
ACCTTTGTGTTTAGTGTTTTAGTTTCATGAATGCACAGCAAAAACACGGT
KIAA Alignment based on: KIAA0886 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..3740
Length: 1245 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |