ROUGE |
Gene/Protein Characteristic Table for mKIAA0875 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093270 |
---|---|
F-box only protein 21. | |
mbg00520 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3889 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2009 bp Genome contig ID gi65498774f_117005431 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
ACAACAATTAATAAACGAACTTGCCGAGAGAAACCFlanking genome sequence
(133418 - 133467) ----+----*----+----*----+----*----+----*----+----*
ATGCCAGTGACCTGCCCGCTTTCATTCAGTAGCAAGAGAGGAGGAAGCAG
KIAA Alignment based on: KIAA0875 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1880
Length: 625 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |