ROUGE |
Gene/Protein Characteristic Table for mKIAA0857 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129230 |
---|---|
Rab11 interacting protein Rip11. | |
mpf00136 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6119 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2056 bp Genome contig ID gi65504368r_85584689 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
AGCACTTTATGAAGAATAAAAAGATCACGTACCGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCCAGCTTGTGTGTTTGTTTTGAAATGAGCGGACAAAGGAGACCGCCTG
KIAA Alignment based on: KIAA0857 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..4063
Length: 1353 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |