ROUGE |
Gene/Protein Characteristic Table for mKIAA0852 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173042 |
---|---|
zinc finger, CW-type with coiled-coil domain 1. | |
meh00434 [Vector Info] | |
Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5085 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1267 bp Genome contig ID gi65527427f_3444282 PolyA signal sequence
(CATAAA,-22) +----*----+----*----+----*----+----
ATCCATTTTTTTCCATAAACCCACTGTTTAAAAGGFlanking genome sequence
(140878 - 140927) ----+----*----+----*----+----*----+----*----+----*
AATTTGGCCCTGCATTTTTATTGGCAGGTAATACTCATTTTGATTTTTTT
KIAA Alignment based on: KIAA0852 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 711..3818
Length: 1035 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |