ROUGE

Gene/Protein Characteristic Table for mKIAA0136

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172896
Description :
Clone Name :	mng12175 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 4013 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 995 bp

Genome contig ID gi65546577f_92903379
PolyA signal sequence
(ACTAAA,-23)
+----*----+----*----+----*----+----
ATATTTTCCACAACTAAAAATGTGTTATTTTTTCC
Flanking genome sequence
(143896 - 143945)
----+----*----+----*----+----*----+----*----+----*
AAAGTTTTATTGTTGCTATTTATTTTAACTTTTGTTTCTGAAAATTCAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0136 DNA sequence

KIAA	Alignment based on:
KIAA0136	DNA sequence

Features of the protein sequence	Description

Coding region: 64..3018
Length: 984 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH98072	99.9	Microrchidia 3 ...	Mus musculus
AAI45706	99.9	Microrchidia 3 ...	Mus musculus
XP_852752	82.8	similar to MORC...	Canis lupus fam...
AAI32732	82.4	MORC3 protein [...	Homo sapiens
XP_514887	82.4	MORC family CW-...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173042	5.1e-13	26.2	mKIAA0852

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011124 450 495 PF07496 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011124	450	495	PF07496	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	995 bp
Genome contig ID	gi65546577f_92903379
PolyA signal sequence (ACTAAA,-23)	+--------+--------+----*----+---- ATATTTTCCACAACTAAAAATGTGTTATTTTTTCC
Flanking genome sequence (143896 - 143945)	----+--------+--------+--------+--------+----* AAAGTTTTATTGTTGCTATTTATTTTAACTTTTGTTTCTGAAAATTCAGT

Gene/Protein Characteristic Table for mKIAA0136

Features of the cloned DNA sequence

Features of the protein sequence