ROUGE |
Gene/Protein Characteristic Table for mKIAA0850 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129229 |
---|---|
influenza virus NS1A binding protein. | |
mph01355 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3421 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1050 bp Genome contig ID gi65488608f_151100320 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CTGCAGATACAAACACATTAAAGGTACTTTGCAGTFlanking genome sequence
(119848 - 119897) ----+----*----+----*----+----*----+----*----+----*
AAATCCTTGCACTGTGGGATTTAATGTCCAAATGTTTGTCACTCAGTTCA
KIAA Alignment based on: KIAA0850 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 437..2371
Length: 644 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |