ROUGE

Gene/Protein Characteristic Table for mKIAA0837

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122384
Description :	Long-chain-fatty-acid--CoA ligase 6.
Clone Name :	mbg02434 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4352 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 336 bp

Genome contig ID gi65527427f_53988379
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TTCACAGAATTCCATTAAACATAAAGAAAAAACAT
Flanking genome sequence
(125998 - 126047)
----+----*----+----*----+----*----+----*----+----*
AACTGATATATTGTACTTAATTATTTGTGGAGTAATAACCAGGTACAGTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0837 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0837	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2886..4016
Length: 376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAW33883	2.1e-162	100.0	long chain acyl...	Mus musculus
Q91WC3	2.1e-162	100.0	Long-chain-fatt...	Mus musculus
CAI51971	2.2e-162	100.0	acyl-CoA synthe...	Mus musculus
CAI51970	2.2e-162	100.0	acyl-CoA synthe...	Mus musculus
BAF82006	4e-162	99.7	long-chain acyl...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129179	1.5e-18	27.7	mKIAA0631

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000873 5 267 PF00501 AMP-dependent synthetase and ligase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000873	5	267	PF00501	AMP-dependent synthetase and ligase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	336 bp
Genome contig ID	gi65527427f_53988379
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TTCACAGAATTCCATTAAACATAAAGAAAAAACAT
Flanking genome sequence (125998 - 126047)	----+--------+--------+--------+--------+----* AACTGATATATTGTACTTAATTATTTGTGGAGTAATAACCAGGTACAGTG

Gene/Protein Characteristic Table for mKIAA0837

Features of the cloned DNA sequence

Features of the protein sequence