ROUGE

Gene/Protein Characteristic Table for mKIAA0631

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129179
Description :	lipidosin. lipidosis-related protein lipidosin. bubblegum.
Clone Name :	mbj00361 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2683 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 506 bp

Genome contig ID gi65519420r_54622395
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GTAATTTTCAGTATTAAACCTTTTAACAGATCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAAGTACCGGATGTCTTTTGTCAATGGGCAGGTGGGACAGAACATAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0631 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0631	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2177
Length: 724 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q99PU5	99.9	Long-chain-fatt...	Mus musculus
Q924N5	97.9	Long-chain-fatt...	Rattus norvegicus
Q4R4P9	86.6	Long-chain-fatt...	Macaca fascicularis
Q96GR2	86.4	Long-chain-fatt...	Homo sapiens
AAG09404	86.3	very long-chain...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122384	1.2e-16	27.7	mKIAA0837
AK173275	0.00023	21.6	mKIAA1846

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000873 274 285 PR00154 AMP-dependent synthetase and ligase

IPR000873 286 294 PR00154 AMP-dependent synthetase and ligase

HMMPfam IPR000873 134 599 PF00501 AMP-dependent synthetase and ligase

ScanRegExp IPR000873 279 290 PS00455 AMP-dependent synthetase and ligase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000873	274	285	PR00154	AMP-dependent synthetase and ligase
IPR000873	286	294	PR00154	AMP-dependent synthetase and ligase
HMMPfam	IPR000873	134	599	PF00501	AMP-dependent synthetase and ligase
ScanRegExp	IPR000873	279	290	PS00455	AMP-dependent synthetase and ligase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	506 bp
Genome contig ID	gi65519420r_54622395
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GTAATTTTCAGTATTAAACCTTTTAACAGATCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAAGTACCGGATGTCTTTTGTCAATGGGCAGGTGGGACAGAACATAGA

Gene/Protein Characteristic Table for mKIAA0631

Features of the cloned DNA sequence

Features of the protein sequence