ROUGE

Gene/Protein Characteristic Table for mKIAA0803

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122374
Description :	A kinase (PRKA) anchor protein (yotiao) 9.
Clone Name :	mbg02196 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6009 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1538 bp

Genome contig ID gi65498774f_3938721
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
GTACTGAAATAAAAAGACCTCACCATTTTCACCTT
Flanking genome sequence
(147490 - 147539)
----+----*----+----*----+----*----+----*----+----*
ACTGTAGTTGAACCTTCTTGATTTTTCACTAAGCCACAACTCGTGGTCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0803 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0803	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..4414, 4471..5502
Length: 1814 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL14626	98.8	A kinase (PRKA)...	Mus musculus
NP_919444	98.7	A kinase (PRKA)...	Mus musculus
CAE46960	98.3	A-kinase anchor...	Mus musculus
T00637	65.5	wEST01358 Early...	Caenorhabditis ...
EDL14625	96.4	A kinase (PRKA)...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122275	6.9e-09	26.1	mKIAA0402
AK220188	1.3e-06	21.9	mKIAA4151
AK220172	0.00029	20.8	mKIAA4046
AK173148	0.00042	22.5	mKIAA1319
AK131171	0.00088	22.4	mFLJ00279

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000533 43 60 PR00194 Tropomyosin

IPR000533 101 129 PR00194 Tropomyosin

IPR000533 134 157 PR00194 Tropomyosin

IPR000533 197 222 PR00194 Tropomyosin

ProfileScan NULL 23 377 PS50313 NULL

NULL 1179 1373 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000533	43	60	PR00194	Tropomyosin
IPR000533	101	129	PR00194	Tropomyosin
IPR000533	134	157	PR00194	Tropomyosin
IPR000533	197	222	PR00194	Tropomyosin
ProfileScan	NULL	23	377	PS50313	NULL
NULL	1179	1373	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1538 bp
Genome contig ID	gi65498774f_3938721
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- GTACTGAAATAAAAAGACCTCACCATTTTCACCTT
Flanking genome sequence (147490 - 147539)	----+--------+--------+--------+--------+----* ACTGTAGTTGAACCTTCTTGATTTTTCACTAAGCCACAACTCGTGGTCCC

Gene/Protein Characteristic Table for mKIAA0803

Features of the cloned DNA sequence

Features of the protein sequence