Gene/Protein Characteristic Table for mKIAA0765

Length: 4957 bp

Restriction map

Length of 3'UTR	3245 bp
Genome contig ID	gi66880554r_155428783
PolyA signal sequence (AATAAA,-23)	+----*----+----*----+----*----+---- TATCTATGTATCAATAAAATTAATATATCCACCTC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* CTCAGTGGCCGCTCTTGTTGTGTTTGGTGCAGGTTGTGTGTCGGGCCTAA

KIAA	Alignment based on:
KIAA0765	DNA sequence, AA sequence, Physical map

Coding region: 3..1709

Length: 569 aa

Entry Exp ID% Protein Source AAL83754 3.5e-148 100.0 SWAN [Mus muscu... Mus musculus Q8R4X3 6.2e-148 99.8 RNA-binding pro... Mus musculus EDL06171 9.1e-148 99.6 mCG5227, isofor... Mus musculus BAE39056 1e-147 99.6 unnamed protein... Mus musculus BAC38017 1.1e-147 99.6 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

No significant homologues

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	343	413	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000504	457	527	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000504	216	286	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000504	342	414	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000504	456	528	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	IPR000694	70	167	PS50099	Proline-rich region
	IPR000504	215	290	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000504	341	418	PS50102	RNA-binding region RNP-1 (RNA recognition motif)

Method	From	To	amino acid sequence
-	-	-	-