| ROUGE |
Gene/Protein Characteristic Table for mKIAA0740 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173015 |
|---|---|
| Rho-related BTB domain-containing protein 1. | |
| mef00769 [Vector Info] | |
| Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 9309 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 8054 bp Genome contig ID gi65524842f_69225260 PolyA signal sequence
(AAGAAA,-21) +----*----+----*----+----*----+----
TTCCTTTTGATACAAAGAAAAAAAAAACAAAATCCFlanking genome sequence
(120087 - 120136) ----+----*----+----*----+----*----+----*----+----*
AGCTTTCGTGTCTCAGATTCCAGATTGGAGAATATTTTTCTATGGACTCT
KIAA Alignment based on: KIAA0740 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..1222, 8716..8994
Length: 499 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |