ROUGE

Gene/Protein Characteristic Table for mKIAA0718

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122355
Description :	diacylglycerol kinase, beta.
Clone Name :	mbg07395 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5875 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3563 bp

Genome contig ID gi65532617f_34585238
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
TTGAAATAAAAGTGTTTGTCATTCACTTGTGCATC
Flanking genome sequence
(652421 - 652470)
----+----*----+----*----+----*----+----*----+----*
ATTTATCTTGTACCAAATGCTCCTTTCATGTGAAATATCTATGAGAACAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0718 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0718	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2312
Length: 769 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6NS52	100.0	Diacylglycerol ...	Mus musculus
EDM03323	99.3	rCG62181, isofo...	Rattus norvegicus
P49621	99.0	Diacylglycerol ...	Rattus norvegicus
AAH70461	99.1	Dgkb protein [M...	Mus musculus
XP_539445	96.8	similar to Diac...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220294	2e-102	60.0	mKIAA4131
AK172901	7e-19	36.4	mKIAA0145

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 117 184 PD000012 Calcium-binding EF-hand

IPR001206 456 563 PD005043 Diacylglycerol kinase

IPR000756 677 746 PD002939 Diacylglycerol kinase accessory region

FPrintScan IPR002219 208 222 PR00008 Protein kinase C

IPR002219 224 233 PR00008 Protein kinase C

IPR002219 237 248 PR00008 Protein kinase C

IPR002219 249 261 PR00008 Protein kinase C

HMMPfam IPR002048 119 147 PF00036 Calcium-binding EF-hand

IPR002048 164 192 PF00036 Calcium-binding EF-hand

IPR002219 211 263 PF00130 Protein kinase C

IPR002219 276 327 PF00130 Protein kinase C

IPR001206 403 527 PF00781 Diacylglycerol kinase

IPR000756 547 727 PF00609 Diacylglycerol kinase accessory region

HMMSmart IPR002048 119 147 SM00054 Calcium-binding EF-hand

IPR002048 164 192 SM00054 Calcium-binding EF-hand

IPR002219 209 260 SM00109 Protein kinase C

IPR002219 276 324 SM00109 Protein kinase C

IPR001206 403 527 SM00046 Diacylglycerol kinase

IPR000756 547 727 SM00045 Diacylglycerol kinase accessory region

ProfileScan IPR002048 111 187 PS50222 Calcium-binding EF-hand

IPR002219 210 260 PS50081 Protein kinase C

IPR002219 275 324 PS50081 Protein kinase C

IPR001206 403 640 PS50146 Diacylglycerol kinase

ScanRegExp IPR002048 128 140 PS00018 Calcium-binding EF-hand

IPR002048 173 185 PS00018 Calcium-binding EF-hand

IPR002219 211 260 PS00479 Protein kinase C

IPR002219 275 326 PS00479 Protein kinase C

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	117	184	PD000012	Calcium-binding EF-hand
IPR001206	456	563	PD005043	Diacylglycerol kinase
IPR000756	677	746	PD002939	Diacylglycerol kinase accessory region
FPrintScan	IPR002219	208	222	PR00008	Protein kinase C
IPR002219	224	233	PR00008	Protein kinase C
IPR002219	237	248	PR00008	Protein kinase C
IPR002219	249	261	PR00008	Protein kinase C
HMMPfam	IPR002048	119	147	PF00036	Calcium-binding EF-hand
IPR002048	164	192	PF00036	Calcium-binding EF-hand
IPR002219	211	263	PF00130	Protein kinase C
IPR002219	276	327	PF00130	Protein kinase C
IPR001206	403	527	PF00781	Diacylglycerol kinase
IPR000756	547	727	PF00609	Diacylglycerol kinase accessory region
HMMSmart	IPR002048	119	147	SM00054	Calcium-binding EF-hand
IPR002048	164	192	SM00054	Calcium-binding EF-hand
IPR002219	209	260	SM00109	Protein kinase C
IPR002219	276	324	SM00109	Protein kinase C
IPR001206	403	527	SM00046	Diacylglycerol kinase
IPR000756	547	727	SM00045	Diacylglycerol kinase accessory region
ProfileScan	IPR002048	111	187	PS50222	Calcium-binding EF-hand
IPR002219	210	260	PS50081	Protein kinase C
IPR002219	275	324	PS50081	Protein kinase C
IPR001206	403	640	PS50146	Diacylglycerol kinase
ScanRegExp	IPR002048	128	140	PS00018	Calcium-binding EF-hand
IPR002048	173	185	PS00018	Calcium-binding EF-hand
IPR002219	211	260	PS00479	Protein kinase C
IPR002219	275	326	PS00479	Protein kinase C

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3563 bp
Genome contig ID	gi65532617f_34585238
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- TTGAAATAAAAGTGTTTGTCATTCACTTGTGCATC
Flanking genome sequence (652421 - 652470)	----+--------+--------+--------+--------+----* ATTTATCTTGTACCAAATGCTCCTTTCATGTGAAATATCTATGAGAACAT

Gene/Protein Characteristic Table for mKIAA0718

Features of the cloned DNA sequence

Features of the protein sequence