ROUGE

Gene/Protein Characteristic Table for mKIAA0697

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129193
Description :	ankyrin repeat domain protein 17 isoform a. gene trap ankyrin repeat.
Clone Name :	mpm11062 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4660 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1293 bp

Genome contig ID gi65498774r_89425418
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AACCACTTGAAACAATAAACAATAATGTATACAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAATATGTGTCCTGCCCTGTCTCCTATGGAAAAGTAACTCACATGATT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0697 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0697	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..717, 725..3367
Length: 1119 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_932127	99.7	ankyrin repeat ...	Mus musculus
EDL05327	99.7	ankyrin repeat ...	Mus musculus
EDL05325	99.7	ankyrin repeat ...	Mus musculus
Q99NH0	99.7	Ankyrin repeat ...	Mus musculus
EDL05326	99.7	ankyrin repeat ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129284	2.5e-09	30.3	mKIAA1085

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004088 239 301 PF00013 KH

HMMSmart IPR004087 236 306 SM00322 KH

ProfileScan NULL 117 214 PS50324 NULL

IPR004088 237 301 PS50084 KH

NULL 462 618 PS50324 NULL

IPR000694 542 705 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	239	301	PF00013	KH
HMMSmart	IPR004087	236	306	SM00322	KH
ProfileScan	NULL	117	214	PS50324	NULL
IPR004088	237	301	PS50084	KH
NULL	462	618	PS50324	NULL
IPR000694	542	705	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1293 bp
Genome contig ID	gi65498774r_89425418
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AACCACTTGAAACAATAAACAATAATGTATACAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAATATGTGTCCTGCCCTGTCTCCTATGGAAAAGTAACTCACATGATT

Gene/Protein Characteristic Table for mKIAA0697

Features of the cloned DNA sequence

Features of the protein sequence