ROUGE

Gene/Protein Characteristic Table for mKIAA0660

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220349
Description :	Ras-GTPase-activating protein binding protein 2.
Clone Name :	mbk00133 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 528 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 267 bp

Genome contig ID gi65498774r_91290343
PolyA signal sequence
(AATGAA,-10)
+----*----+----*----+----*----+----
CCATATCTTAAACTGTCTACAACAAAATGAACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGGACATGCCCACTGAGTTCAGGTCATTTGAGTTAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0660 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0660	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..258
Length: 86 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_855954	1.6e-29	98.8	similar to Ras-...	Canis lupus fam...
BAE30836	1.9e-29	100.0	unnamed protein...	Mus musculus
AAH79225	1.9e-29	100.0	GTPase activati...	Rattus norvegicus
BAC36197	1.9e-29	100.0	unnamed protein...	Mus musculus
P97379	2e-29	100.0	Ras GTPase-acti...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220230	0.00099	62.7	mKIAA4115

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 23 83 PS50315 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	23	83	PS50315	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	267 bp
Genome contig ID	gi65498774r_91290343
PolyA signal sequence (AATGAA,-10)	+--------+--------+----*----+---- CCATATCTTAAACTGTCTACAACAAAATGAACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGACATGCCCACTGAGTTCAGGTCATTTGAGTTAAA

Gene/Protein Characteristic Table for mKIAA0660

Features of the cloned DNA sequence

Features of the protein sequence