ROUGE

Gene/Protein Characteristic Table for mKIAA4115

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220230
Description :	Ras-GTPase-activating protein binding protein 1.
Clone Name :	msj06256 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 2192 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 672 bp

Genome contig ID gi65527427f_55122540
PolyA signal sequence
(AAGAAA,-9)
+----*----+----*----+----*----+----
CATGTTTTATTTGTATTTGTAAAAAAAAGAAAAAG
Flanking genome sequence
(130644 - 130693)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAAGAAAAAAGGACAAAAAATTCCCACAAGAAAACAA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3..1517
Length: 505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_340803	8.7e-154	97.8	similar to Ras-...	Rattus norvegicus
P97855	4.7e-145	100.0	Ras GTPase-acti...	Mus musculus
EAW61661	1.3e-136	93.2	Ras-GTPase-acti...	Homo sapiens
EAW61662	1.3e-136	93.2	Ras-GTPase-acti...	Homo sapiens
XP_001110695	8.3e-136	93.6	Ras-GTPase-acti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002075 51 173 PF02136 Nuclear transport factor 2

IPR000504 380 440 PF00076 RNA-binding region RNP-1 (RNA recognition motif)

HMMSmart IPR000504 379 449 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

ProfileScan IPR002075 51 173 PS50177 Nuclear transport factor 2

NULL 184 260 PS50313 NULL

IPR000694 229 356 PS50099 Proline-rich region

IPR000504 378 453 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002075	51	173	PF02136	Nuclear transport factor 2
IPR000504	380	440	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000504	379	449	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	IPR002075	51	173	PS50177	Nuclear transport factor 2
NULL	184	260	PS50313	NULL
IPR000694	229	356	PS50099	Proline-rich region
IPR000504	378	453	PS50102	RNA-binding region RNP-1 (RNA recognition motif)

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	672 bp
Genome contig ID	gi65527427f_55122540
PolyA signal sequence (AAGAAA,-9)	+--------+--------+----*----+---- CATGTTTTATTTGTATTTGTAAAAAAAAGAAAAAG
Flanking genome sequence (130644 - 130693)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAAAAAGAAAAAAGGACAAAAAATTCCCACAAGAAAACAA

Gene/Protein Characteristic Table for mKIAA4115

Features of the cloned DNA sequence

Features of the protein sequence