| ROUGE |
Gene/Protein Characteristic Table for mKIAA4115 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220230 |
|---|---|
| Ras-GTPase-activating protein binding protein 1. | |
| msj06256 [Vector Info] | |
| Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2192 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 672 bp Genome contig ID gi65527427f_55122540 PolyA signal sequence
(AAGAAA,-9) +----*----+----*----+----*----+----
CATGTTTTATTTGTATTTGTAAAAAAAAGAAAAAGFlanking genome sequence
(130644 - 130693) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAAGAAAAAAGGACAAAAAATTCCCACAAGAAAACAA
Features of the protein sequence |
Description | |
Coding region: 3..1517
Length: 505 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |