ROUGE |
Gene/Protein Characteristic Table for mKIAA0653 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220220 |
---|---|
ICOS ligand precursor. | |
mnh05075 [Vector Info] | |
Source : | Mouse NKT cells |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2475 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1622 bp Genome contig ID gi65524842f_78082428 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
AACCTAACAAGGGAATAAATGTAAGATGTGCTTTCFlanking genome sequence
(106091 - 106140) ----+----*----+----*----+----*----+----*----+----*
TGCCTTGTGTCTGGTGGCTTGTGTCAGTGTGGTGTGTCTGGCTCCATCAG
KIAA Alignment based on: KIAA0653 DNA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 320..850
Length: 177 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |