ROUGE |
Gene/Protein Characteristic Table for mKIAA0639 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172989 |
---|---|
mbg16237 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5754 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3321 bp Genome contig ID gi65540054f_59193318 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
ACAGCTTCTAAATAAATCCAGGTGATTTCTTGCTTFlanking genome sequence
(144580 - 144629) ----+----*----+----*----+----*----+----*----+----*
ATGTCCGAGGTCAAGCATAACTGTTCTTGCCTATCCTCACCCTGGGCTTC
KIAA Alignment based on: KIAA0639 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..2433
Length: 810 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000938 | 686 | 751 | PF01302 | CAP-Gly |
ProfileScan | IPR000938 | 704 | 746 | PS50245 | CAP-Gly |
ScanRegExp | IPR000938 | 704 | 735 | PS00845 | CAP-Gly |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |