ROUGE

Gene/Protein Characteristic Table for mKIAA4109

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220490
Description :	Kinesin-like protein KIF13A.
Clone Name :	mfj19244 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3917 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1511 bp

Genome contig ID gi65535943r_46247415
PolyA signal sequence
(AATACA,-21)
+----*----+----*----+----*----+----
TGTGTGTGTTTTAGAATACAAACTGTCTAATTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTCCAAAGTGTTGATCGTCTGTTCTTTGTTGTTGTTGTTGTTGTTTTTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..2403
Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW55388	86.0	kinesin family ...	Homo sapiens
Q9H1H9	86.0	Kinesin-like pr...	Homo sapiens
AAG38890	85.8	kinesin-like pr...	Homo sapiens
XP_001916924	86.0	kinesin family ...	Equus caballus
CAI21670	85.6	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172989	2.1e-46	37.1	mKIAA0639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1511 bp
Genome contig ID	gi65535943r_46247415
PolyA signal sequence (AATACA,-21)	+--------+--------+----*----+---- TGTGTGTGTTTTAGAATACAAACTGTCTAATTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCCAAAGTGTTGATCGTCTGTTCTTTGTTGTTGTTGTTGTTGTTTTTT

Gene/Protein Characteristic Table for mKIAA4109

Features of the cloned DNA sequence

Features of the protein sequence