ROUGE |
Gene/Protein Characteristic Table for mKIAA0596 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122323 |
---|---|
mitogen activated protein kinase binding protein 1. Jun N-terminal kinase-binding protein 1. mitogen activated protein kinase binding proten 1. |
|
mbg02022 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6222 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3792 bp Genome contig ID gi66880554f_119429191 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
ATGTATGAAATTGTCAATAAACACAATCATTTGTTFlanking genome sequence
(112055 - 112104) ----+----*----+----*----+----*----+----*----+----*
AACCTGCTAGCAAATTCTGAGAAGAGCGCCGCTTGTTGCACCTCCTAGAG
KIAA Alignment based on: KIAA0596 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 346..2400, 2661..3500, 3900..4217
Length: 1070 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |