Gene/Protein Characteristic Table for mKIAA0559

Length: 6742 bp

Restriction map

Length of 3'UTR	1961 bp
Genome contig ID	gi65498774f_14033994
PolyA signal sequence (AATAAA,-25)	+----*----+----*----+----*----+---- CTGTGTAATAAATAAAGTATCTTTATTTCATTCAT
Flanking genome sequence (215143 - 215192)	----+----*----+----*----+----*----+----*----+----* AAACAACTGGGTTCTGAGCCATTGTTATATGATGGAGCATAAAATGAGTG

KIAA	Alignment based on:
KIAA0559	DNA sequence, AA sequence, Physical map

Coding region: 3..4781

Length: 1592 aa

Entry Exp ID% Protein Source BAC53723 4.1e-215 89.6 Piccolo [Mus mu... Mus musculus XP_001471724 3.2e-214 90.1 hypothetical pr... Mus musculus EDL38712 3.3e-214 90.1 piccolo (presyn... Mus musculus NP_001104266 4.8e-214 90.2 piccolo isoform... Mus musculus BAC53724 4.9e-214 90.2 Piccolo [Mus mu... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129141 3.7e-16 32.0 mKIAA0434

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	1159	1244	PF00595	PDZ/DHR/GLGF
	IPR000008	1366	1464	PF00168	C2
HMMSmart	IPR001478	1168	1247	SM00228	PDZ/DHR/GLGF
	IPR000008	1365	1479	SM00239	C2
ProfileScan	NULL	14	121	PS50322	NULL
	NULL	505	609	PS50322	NULL
	NULL	928	991	PS50324	NULL
	IPR001478	1153	1247	PS50106	PDZ/DHR/GLGF
	IPR000008	1365	1464	PS50004	C2
	NULL	1494	1560	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-