ROUGE

Gene/Protein Characteristic Table for mKIAA0434

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129141
Description :	bassoon. presynaptic cytomatrix protein.
Clone Name :	mbf01942 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 7506 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3992 bp

Genome contig ID gi65519420r_108061928
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TATCAGAATAAAAGGACTTGATATAAACAACCTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACAGTCTCGGGGTGATTTCTGAAGTGGGAACACTTAGCCAAACAGGTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0434 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0434	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3514
Length: 1170 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL21270	95.2	bassoon [Mus mu...	Mus musculus
NP_031593	95.2	bassoon protein...	Mus musculus
O88737	95.0	Protein bassoon.	Mus musculus
EDL77188	90.3	rCG25274, isofo...	Rattus norvegicus
XP_001094100	84.7	similar to Bass...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093247	2.5e-11	32.0	mKIAA0559

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 279 370 PS50099 Proline-rich region

NULL 834 894 PS50316 NULL

NULL 973 1047 PS50322 NULL

IPR000694 1033 1132 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	279	370	PS50099	Proline-rich region
NULL	834	894	PS50316	NULL
NULL	973	1047	PS50322	NULL
IPR000694	1033	1132	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3992 bp
Genome contig ID	gi65519420r_108061928
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TATCAGAATAAAAGGACTTGATATAAACAACCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACAGTCTCGGGGTGATTTCTGAAGTGGGAACACTTAGCCAAACAGGTA

Gene/Protein Characteristic Table for mKIAA0434

Features of the cloned DNA sequence

Features of the protein sequence