ROUGE |
Gene/Protein Characteristic Table for mKIAA0554 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122308 |
---|---|
formin binding protein 1. formin binding protein 17. |
|
mbg09350 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4726 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2669 bp Genome contig ID gi66880554r_30858370 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CCTTTCAATGTTAAATAAAGTATAACTTCTAGTGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCTGGTTCTCTGTTGTATGAAGAAATGACGCTGGGCCTGGGGAGATGGC
KIAA Alignment based on: KIAA0554 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2057
Length: 684 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |