Order Kazusa clone(s) from : ![]() |
Product ID | ORK00561 |
---|---|
Accession No | AB011126 |
Description | formin binding protein 1 |
Clone name | hh00877 |
Vector information | |
cDNA sequence | DNA sequence (5383 bp) Predicted protein sequence (674 aa) |
Flexi ORF Clone | FXC00561 |
Source | Human adult brain |
Rouge ID |
mKIAA0554
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 3356 bp |
---|---|
Genome contig ID | gi89161216r_131589287 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 131689287 | 131845248 | 16 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 613 | 664 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 610 | 620 | PR00452 | Src homology-3 |
IPR001452 | 624 | 639 | PR00452 | Src homology-3 | |
IPR001452 | 654 | 666 | PR00452 | Src homology-3 | |
HMMPfam | IPR001060 | 58 | 151 | PF00611 | Cdc15/Fes/CIP4 |
IPR001452 | 610 | 666 | PF00018 | Src homology-3 | |
HMMSmart | IPR001060 | 58 | 151 | SM00055 | Cdc15/Fes/CIP4 |
IPR001452 | 610 | 667 | SM00326 | Src homology-3 | |
ProfileScan | IPR001060 | 58 | 122 | PS50133 | Cdc15/Fes/CIP4 |
IPR001452 | 607 | 664 | PS50002 | Src homology-3 |
![]() |
---|
Primer_f | GGTTTAATTCCATCTCCAGAG |
---|---|
Primer_r | TTTTGCTGTGTGAGGCCGATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGTTTAATTCCATCTCCAGAG |
Primer_r | TTTTGCTGTGTGAGGCCGATC |
PCR product length | 147 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |