ROUGE

Gene/Protein Characteristic Table for mKIAA0480

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172956
Description :
Clone Name :	mef00473 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 9413 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3597 bp

Genome contig ID gi65488608r_155640308
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAGATGAAATCTGTAAATAAATTGATTTATAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTCCATGTCCGGTGTAAATTTTTCTACTCATGAGCCAAGTTTAGAGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0480 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0480	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..5816
Length: 1937 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_129509	99.9	centrosome-asso...	Mus musculus
XP_922079	99.8	similar to cent...	Mus musculus
EDL39399	94.2	mCG145690 [Mus ...	Mus musculus
XP_001067472	89.5	similar to cent...	Rattus norvegicus
XP_537151	79.6	similar to cent...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220172	4.6e-06	22.8	mKIAA4046
AK172928	0.00086	25.1	mKIAA0291

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000938 1328 1393 PF01302 CAP-Gly

ProfileScan NULL 338 392 PS50324 NULL

NULL 1189 1284 PS50324 NULL

IPR000938 1346 1388 PS50245 CAP-Gly

ScanRegExp IPR000938 1346 1377 PS00845 CAP-Gly

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000938	1328	1393	PF01302	CAP-Gly
ProfileScan	NULL	338	392	PS50324	NULL
NULL	1189	1284	PS50324	NULL
IPR000938	1346	1388	PS50245	CAP-Gly
ScanRegExp	IPR000938	1346	1377	PS00845	CAP-Gly

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3597 bp
Genome contig ID	gi65488608r_155640308
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAGATGAAATCTGTAAATAAATTGATTTATAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCCATGTCCGGTGTAAATTTTTCTACTCATGAGCCAAGTTTAGAGTT

Gene/Protein Characteristic Table for mKIAA0480

Features of the cloned DNA sequence

Features of the protein sequence