ROUGE |
Gene/Protein Characteristic Table for mKIAA0473 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122293 |
---|---|
DnaJ (Hsp40) homolog, subfamily C, member 6. DnaJ (Hsp40) homolog, subfamily B, member 6. auxilin. |
|
mbg05612 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5128 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2225 bp Genome contig ID gi65493515f_100366906 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
AATATTTGTAATGTATATTAAAAAGGATACAAAATFlanking genome sequence
(234800 - 234849) ----+----*----+----*----+----*----+----*----+----*
ACTTTTAGAAATATACATTATTTTTGTACCTGCGGGAGTACGAGGGGCCA
KIAA Alignment based on: KIAA0473 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 87..2903
Length: 938 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |