| ROUGE |
Gene/Protein Characteristic Table for mKIAA4080 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | BC065052 |
|---|---|
| Cyclin G-associated kinase (Fragment). | |
| mfj01350 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4449 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 432 bp Genome contig ID gi65498774r_107545637 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CAATCATCTGTACATAATTAAACTATTTTCTGATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GCTGGTGCAGTCTCTGGCTTGTAAAGCACTTCTTACCTAGTACCTGGTCA
Features of the protein sequence |
Description | |
Coding region: 46..4014
Length: 1323 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |