Gene/Protein Characteristic Table for mKIAA4080

Length: 4449 bp

Restriction map

Length of 3'UTR	432 bp
Genome contig ID	gi65498774r_107545637
PolyA signal sequence (ATTAAA,-19)	+----*----+----*----+----*----+---- CAATCATCTGTACATAATTAAACTATTTTCTGATG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* GCTGGTGCAGTCTCTGGCTTGTAAAGCACTTCTTACCTAGTACCTGGTCA

Coding region: 46..4014

Length: 1323 aa

Entry Exp ID% Protein Source EDL20105 0 100.0 cyclin G associ... Mus musculus AAH65052 0 100.0 Cyclin G associ... Mus musculus BAE27365 0 99.9 unnamed protein... Mus musculus Q99KY4 0 99.9 Cyclin G-associ... Mus musculus EDL20099 0 99.4 cyclin G associ... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122293 3e-43 43.4 mKIAA0473

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	69	336	PD000001	Protein kinase
HMMPfam	IPR000719	58	331	PF00069	Protein kinase
	IPR001623	1249	1323	PF00226	Heat shock protein DnaJ
HMMSmart	IPR002290	58	335	SM00220	Serine/threonine protein kinase
	IPR001245	58	331	SM00219	Tyrosine protein kinase
	IPR001623	1258	1319	SM00271	Heat shock protein DnaJ
ProfileScan	IPR000719	58	335	PS50011	Protein kinase
	IPR001623	1259	1323	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR008271	187	199	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
SOSUI	532	554	AVAVCAFLCFCRLFSTAEAAVYM
	642	664	GKAVIPLGVTVQGDVLIIIYHAR