Order Kazusa clone(s) from : ![]() |
Product ID | ORK05752 |
---|---|
Accession No | AB007918 |
Description | kinesin family member 21B, transcript variant 2 |
Clone name | ff06247 |
Vector information | |
cDNA sequence | DNA sequence (9895 bp) Predicted protein sequence (1628 aa) |
HaloTag ORF Clone |
FHC05752
![]() |
Flexi ORF Clone | FXC05752 |
Source | Human fetal brain |
Rouge ID |
mKIAA0449
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00177, former representative clones for KIAA0449 with ff06247. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4703 bp |
---|---|
Genome contig ID | gi89161185r_199105143 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 199205143 | 199259451 | 34 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001752 | 82 | 103 | PR00380 | Kinesin |
IPR001752 | 220 | 237 | PR00380 | Kinesin | |
IPR001752 | 324 | 345 | PR00380 | Kinesin | |
IPR001680 | 1312 | 1326 | PR00320 | WD40 repeat | |
IPR001680 | 1508 | 1522 | PR00320 | WD40 repeat | |
IPR001680 | 1591 | 1605 | PR00320 | WD40 repeat | |
HMMPfam | IPR001752 | 18 | 375 | PF00225 | Kinesin |
IPR001680 | 1289 | 1325 | PF00400 | WD40 repeat | |
IPR001680 | 1329 | 1366 | PF00400 | WD40 repeat | |
IPR001680 | 1393 | 1430 | PF00400 | WD40 repeat | |
IPR001680 | 1434 | 1475 | PF00400 | WD40 repeat | |
IPR001680 | 1485 | 1521 | PF00400 | WD40 repeat | |
IPR001680 | 1526 | 1564 | PF00400 | WD40 repeat | |
IPR001680 | 1568 | 1604 | PF00400 | WD40 repeat | |
HMMSmart | IPR001752 | 10 | 382 | SM00129 | Kinesin |
IPR001680 | 1288 | 1325 | SM00320 | WD40 repeat | |
IPR001680 | 1328 | 1366 | SM00320 | WD40 repeat | |
IPR001680 | 1393 | 1430 | SM00320 | WD40 repeat | |
IPR001680 | 1433 | 1475 | SM00320 | WD40 repeat | |
IPR001680 | 1483 | 1521 | SM00320 | WD40 repeat | |
IPR001680 | 1524 | 1564 | SM00320 | WD40 repeat | |
IPR001680 | 1567 | 1604 | SM00320 | WD40 repeat | |
ProfileScan | IPR001752 | 9 | 302 | PS50067 | Kinesin |
IPR001680 | 1295 | 1334 | PS50082 | WD40 repeat | |
IPR001680 | 1295 | 1613 | PS50294 | WD40 repeat | |
IPR001680 | 1491 | 1530 | PS50082 | WD40 repeat | |
IPR001680 | 1532 | 1573 | PS50082 | WD40 repeat | |
IPR001680 | 1574 | 1604 | PS50082 | WD40 repeat | |
ScanRegExp | IPR001752 | 271 | 282 | PS00411 | Kinesin |
IPR001680 | 1312 | 1326 | PS00678 | WD40 repeat |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AACACACACATCCAATCTAGG |
Primer_r | CCTGCTGTCCTCCATGATGTG |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |