KIAA0449

Product ID	ORK05752
Accession No	AB007918
Description	kinesin family member 21B, transcript variant 2
Clone name	ff06247
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9895 bp) Predicted protein sequence (1628 aa)
HaloTag ORF Clone	FHC05752
Flexi ORF Clone	FXC05752
Source	Human fetal brain
Rouge ID	mKIAA0449 by Kazusa Mouse cDNA Project
Note	We replaced hg00177, former representative clones for KIAA0449 with ff06247. (2005/08/06)

Length: 9895 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4703 bp
Genome contig ID	gi89161185r_199105143
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCTAAGAAGTTGTCATAAATAAAACCTGAATGACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTCTGTGGAGGTGTCCCCTGTCCCCTTCCAGGGGGCTGCTGACTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	199205143	199259451	34	99.5	Perfect prediction

Length: 1628 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_060066	100.0	kinesin family ...	Homo sapiens
AAI44558	99.8	KIF21B protein ...	Homo sapiens
XP_001916157	96.2	kinesin family ...	Equus caballus
EAW91329	99.2	hCG2027369, iso...	Homo sapiens
EAW91328	98.9	hCG2027369, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051495	8.7e-106	60.1	KIAA1708
AB002357	2.2e-08	29.4	KIAA0359
AB037826	5.2e-08	33.4	KIAA1405
AB011103	1.5e-07	27.3	KIAA0531
AB014539	1.8e-07	29.6	KIAA0639

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	82	103	PR00380	Kinesin
	IPR001752	220	237	PR00380	Kinesin
	IPR001752	324	345	PR00380	Kinesin
	IPR001680	1312	1326	PR00320	WD40 repeat
	IPR001680	1508	1522	PR00320	WD40 repeat
	IPR001680	1591	1605	PR00320	WD40 repeat
HMMPfam	IPR001752	18	375	PF00225	Kinesin
	IPR001680	1289	1325	PF00400	WD40 repeat
	IPR001680	1329	1366	PF00400	WD40 repeat
	IPR001680	1393	1430	PF00400	WD40 repeat
	IPR001680	1434	1475	PF00400	WD40 repeat
	IPR001680	1485	1521	PF00400	WD40 repeat
	IPR001680	1526	1564	PF00400	WD40 repeat
	IPR001680	1568	1604	PF00400	WD40 repeat
HMMSmart	IPR001752	10	382	SM00129	Kinesin
	IPR001680	1288	1325	SM00320	WD40 repeat
	IPR001680	1328	1366	SM00320	WD40 repeat
	IPR001680	1393	1430	SM00320	WD40 repeat
	IPR001680	1433	1475	SM00320	WD40 repeat
	IPR001680	1483	1521	SM00320	WD40 repeat
	IPR001680	1524	1564	SM00320	WD40 repeat
	IPR001680	1567	1604	SM00320	WD40 repeat
ProfileScan	IPR001752	9	302	PS50067	Kinesin
	IPR001680	1295	1334	PS50082	WD40 repeat
	IPR001680	1295	1613	PS50294	WD40 repeat
	IPR001680	1491	1530	PS50082	WD40 repeat
	IPR001680	1532	1573	PS50082	WD40 repeat
	IPR001680	1574	1604	PS50082	WD40 repeat
ScanRegExp	IPR001752	271	282	PS00411	Kinesin
ScanRegExp	IPR001680	1312	1326	PS00678	WD40 repeat

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	AACACACACATCCAATCTAGG
Primer_r	CCTGCTGTCCTCCATGATGTG
PCR product length	135 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles