ROUGE |
Gene/Protein Characteristic Table for mKIAA0383 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129129 |
---|---|
MYST histone acetyltransferase monocytic leukemia 4. histone acetyltransferase. MYST histone acetyltransferase (monocytic leukemia) 4. monocytic leukemia. |
|
mbg07072 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4839 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4202 bp Genome contig ID gi65540054f_19781687 PolyA signal sequence
(AAGAAA,-7) +----*----+----*----+----*----+----
GAGAAAACTTGTCTCAAAAAAAGAAAGAAAGAAAGFlanking genome sequence
(104839 - 104888) ----+----*----+----*----+----*----+----*----+----*
AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAGAAAAGAAA
KIAA Alignment based on: KIAA0383 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..637
Length: 211 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |