ROUGE |
Gene/Protein Characteristic Table for mKIAA0369 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093234 |
---|---|
Serine/threonine-protein kinase DCAMKL1. | |
mbg01404 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5249 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2826 bp Genome contig ID gi65492966f_54776906 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AATAAATGTGTGAATTGTTCCAAACCATTAGAAGGFlanking genome sequence
(393993 - 394042) ----+----*----+----*----+----*----+----*----+----*
AAAAGGTACGGTCTTCAGTCCCTGGAAATGTTCTGGCTGTCGTCTTCACC
KIAA Alignment based on: KIAA0369 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 48..2423
Length: 791 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 442 | 697 | PD000001 | Protein kinase |
HMMPfam | IPR003533 | 126 | 190 | PF03607 | Doublecortin |
IPR003533 | 255 | 316 | PF03607 | Doublecortin | |
IPR000719 | 442 | 698 | PF00069 | Protein kinase | |
HMMSmart | IPR003533 | 104 | 195 | SM00537 | Doublecortin |
IPR003533 | 233 | 321 | SM00537 | Doublecortin | |
IPR002290 | 442 | 698 | SM00220 | Serine/threonine protein kinase | |
IPR001245 | 442 | 696 | SM00219 | Tyrosine protein kinase | |
ProfileScan | IPR003533 | 109 | 195 | PS50309 | Doublecortin |
IPR003533 | 238 | 321 | PS50309 | Doublecortin | |
NULL | 333 | 416 | PS50324 | NULL | |
IPR000719 | 442 | 698 | PS50011 | Protein kinase | |
ScanRegExp | IPR000719 | 448 | 475 | PS00107 | Protein kinase |
IPR008271 | 559 | 571 | PS00108 | Serine/threonine protein kinase |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |