KIAA0338

Product ID	ORK01069
Accession No	AB002336
Description	erythrocyte membrane protein band 4.1-like 1, transcript variant 1
Clone name	hg01242
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6263 bp) Predicted protein sequence (934 aa)
HaloTag ORF Clone	FHC01069
Flexi ORF Clone	FXC01069
Source	Human adult brain
Rouge ID	mKIAA0338 by Kazusa Mouse cDNA Project

Length: 6263 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3456 bp
Genome contig ID	gi51511747f_34106086
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TATAAGTGAAATAAATGTGTTTGATGCTGAACCAT
Flanking genome sequence (178050 - 178099)	----+--------+--------+--------+--------+----* ACTTCCTTGGCACCTCTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	34206086	34284134	22	99.4	Perfect prediction

Length: 934 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H4G0	100.0	Band 4.1-like p...	Homo sapiens
AAH40259	99.9	EPB41L1 protein...	Homo sapiens
AAL15446	99.9	erythrocyte mem...	Homo sapiens
XP_001501956	96.7	erythrocyte mem...	Equus caballus
XP_872829	96.1	similar to EPB4...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023204	1e-65	43.0	KIAA0987
AB018336	1.5e-23	34.6	KIAA0793
AB046768	2e-12	34.9	KIAA1548

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	163	182	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	183	195	PR00935	Band 4.1
	IPR000798	213	232	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	247	260	PR00935	Band 4.1
	IPR000798	256	277	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	260	280	PR00935	Band 4.1
	IPR000299	321	337	PR00935	Band 4.1
	IPR000798	344	364	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	152	341	PF00373	Band 4.1
	IPR014847	435	483	PF08736	FERM adjacent (FA)
	IPR007477	531	597	PF04382	SAB
	IPR008379	830	922	PF05902	Band 4.1
HMMSmart	IPR000299	146	341	SM00295	Band 4.1
ProfileScan	IPR000299	150	431	PS50057	Band 4.1
ScanRegExp	IPR000299	204	232	PS00660	Band 4.1
ScanRegExp	IPR000299	311	340	PS00661	Band 4.1

Primer_f	CCCAGAAATCGCCCCAGAAGA
Primer_r	GGCCATGTTTCTCCACCTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCAGAAATCGCCCCAGAAGA
Primer_r	GGCCATGTTTCTCCACCTCAC
PCR product length	105 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles