ROUGE

Gene/Protein Characteristic Table for mKIAA0324

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122248
Description :	serine/arginine repetitive matrix 2.
Clone Name :	mbg00352 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5772 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 505 bp

Genome contig ID gi65550231f_21519122
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AGCAACTTTTTCTGTCAAATAAAAATGAGAAATGC
Flanking genome sequence
(107797 - 107846)
----+----*----+----*----+----*----+----*----+----*
AGTAATTGGTCTGTAGTCTTTACTTGGGGTTAAGAGTTCTGTGAACAAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0324 DNA sequence

KIAA	Alignment based on:
KIAA0324	DNA sequence

Features of the protein sequence	Description

Coding region: 3..5267
Length: 1754 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_780438	99.8	serine/arginine...	Mus musculus
BAC41104	99.8	unnamed protein...	Mus musculus
Q8BTI8	99.8	Serine/arginine...	Mus musculus
XP_220207	95.6	similar to seri...	Rattus norvegicus
Q9UQ35	85.2	Serine/arginine...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122418	0.00026	48.0	mKIAA1019

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 383 1753 PS50324 NULL

NULL 673 1092 PS50323 NULL

NULL 1185 1311 PS50310 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	383	1753	PS50324	NULL
NULL	673	1092	PS50323	NULL
NULL	1185	1311	PS50310	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	505 bp
Genome contig ID	gi65550231f_21519122
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGCAACTTTTTCTGTCAAATAAAAATGAGAAATGC
Flanking genome sequence (107797 - 107846)	----+--------+--------+--------+--------+----* AGTAATTGGTCTGTAGTCTTTACTTGGGGTTAAGAGTTCTGTGAACAAGA

Gene/Protein Characteristic Table for mKIAA0324

Features of the cloned DNA sequence

Features of the protein sequence