ROUGE |
Gene/Protein Characteristic Table for mKIAA0306 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093224 |
---|---|
capicua homolog. | |
mbh00666 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4733 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 608 bp Genome contig ID gi65511124f_20366065 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
AAGCCGCAATGACCGAGATTAAAGCTGTTTAACCCFlanking genome sequence
(108323 - 108372) ----+----*----+----*----+----*----+----*----+----*
ACGTGTGGGCTGCTGGCTTGTTTAAGTACTACTTAACACACTCCTATCTA
KIAA Alignment based on: KIAA0306 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 46..4125
Length: 1359 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |