Order Kazusa clone(s) from : ![]() |
Product ID | ORK04567 |
---|---|
Accession No | AB002304 |
Description | capicua transcriptional repressor |
Clone name | hg00063 |
Vector information | |
cDNA sequence | DNA sequence (4964 bp) Predicted protein sequence (1451 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0306
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | NULL | 935 | 947 | PR01217 | NULL |
NULL | 969 | 981 | PR01217 | NULL | |
NULL | 989 | 1010 | PR01217 | NULL | |
NULL | 1042 | 1059 | PR01217 | NULL | |
NULL | 1068 | 1093 | PR01217 | NULL | |
HMMPfam | IPR000910 | 43 | 111 | PF00505 | HMG1/2 (high mobility group) box |
HMMSmart | IPR000910 | 42 | 112 | SM00398 | HMG1/2 (high mobility group) box |
ProfileScan | IPR000910 | 43 | 111 | PS50118 | HMG1/2 (high mobility group) box |
ScanRegExp | IPR002345 | 70 | 83 | PS00213 | Lipocalin |
![]() |
---|
Primer_f | CAGAGGGGGTGAGGAGAAAAC |
---|---|
Primer_r | GCACCCCTTTTTTCCCCAGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CAGAGGGGGTGAGGAGAAAAC |
Primer_r | GCACCCCTTTTTTCCCCAGAG |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |