ROUGE

Gene/Protein Characteristic Table for mKIAA0306

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093224
Description :	capicua homolog.
Clone Name :	mbh00666 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4733 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 608 bp

Genome contig ID gi65511124f_20366065
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
AAGCCGCAATGACCGAGATTAAAGCTGTTTAACCC
Flanking genome sequence
(108323 - 108372)
----+----*----+----*----+----*----+----*----+----*
ACGTGTGGGCTGCTGGCTTGTTTAAGTACTACTTAACACACTCCTATCTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0306 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0306	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 46..4125
Length: 1359 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001103602	99.7	capicua homolog...	Mus musculus
EDL24280	99.6	capicua homolog...	Mus musculus
Q924A2	99.6	Protein capicua...	Mus musculus
AAK73516	99.5	capicua protein...	Mus musculus
BAE27978	99.6	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173130	0.00038	23.2	mKIAA1205

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 263 1051 PS50099 Proline-rich region

IPR000694 1275 1352 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	263	1051	PS50099	Proline-rich region
IPR000694	1275	1352	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	608 bp
Genome contig ID	gi65511124f_20366065
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- AAGCCGCAATGACCGAGATTAAAGCTGTTTAACCC
Flanking genome sequence (108323 - 108372)	----+--------+--------+--------+--------+----* ACGTGTGGGCTGCTGGCTTGTTTAAGTACTACTTAACACACTCCTATCTA

Gene/Protein Characteristic Table for mKIAA0306

Features of the cloned DNA sequence

Features of the protein sequence