ROUGE

Gene/Protein Characteristic Table for mKIAA0275

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122233
Description :	Testican-2 precursor.
Clone Name :	mbg09539 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4861 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3716 bp

Genome contig ID gi65524842f_59966760
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTAAGAAAATGGAAAATAAAAACTTTATAAACCCC
Flanking genome sequence
(128767 - 128816)
----+----*----+----*----+----*----+----*----+----*
ACCTGCTGAGAAACCTTTGCTTATTCTGCCTTAGTGTTGTCTTAAGAGTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0275 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0275	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1145
Length: 380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ER58	1.6e-166	100.0	Testican-2; SPA...	Mus musculus
EDL32181	4.6e-166	99.7	sparc/osteonect...	Mus musculus
EDL93055	9.1e-163	96.9	sparc/osteonect...	Rattus norvegicus
XP_001136277	1.2e-158	94.0	sparc/osteonect...	Pan troglodytes
Q92563	1.4e-158	94.0	Testican-2; SPA...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220280	2.1e-66	47.0	mKIAA4039

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011497 92 137 PF07648 Protease inhibitor

IPR002350 93 137 PF00050 Proteinase inhibitor I1

IPR000716 269 332 PF00086 Thyroglobulin type-1

HMMSmart IPR002350 92 137 SM00280 Proteinase inhibitor I1

IPR000716 290 336 SM00211 Thyroglobulin type-1

ProfileScan NULL 349 372 PS50313 NULL

ScanRegExp IPR000716 289 318 PS00484 Thyroglobulin type-1

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011497	92	137	PF07648	Protease inhibitor
IPR002350	93	137	PF00050	Proteinase inhibitor I1
IPR000716	269	332	PF00086	Thyroglobulin type-1
HMMSmart	IPR002350	92	137	SM00280	Proteinase inhibitor I1
IPR000716	290	336	SM00211	Thyroglobulin type-1
ProfileScan	NULL	349	372	PS50313	NULL
ScanRegExp	IPR000716	289	318	PS00484	Thyroglobulin type-1

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3716 bp
Genome contig ID	gi65524842f_59966760
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTAAGAAAATGGAAAATAAAAACTTTATAAACCCC
Flanking genome sequence (128767 - 128816)	----+--------+--------+--------+--------+----* ACCTGCTGAGAAACCTTTGCTTATTCTGCCTTAGTGTTGTCTTAAGAGTA

Gene/Protein Characteristic Table for mKIAA0275

Features of the cloned DNA sequence

Features of the protein sequence