Order Kazusa clone(s) from : ![]() |
Product ID | ORK00488 |
---|---|
Accession No | D87465 |
Description | sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2, transcript variant 2 |
Clone name | ha06214 |
Vector information | |
cDNA sequence | DNA sequence (5316 bp) Predicted protein sequence (510 aa) |
HaloTag ORF Clone |
FHC00488
![]() |
Flexi ORF Clone | FXC00488 |
Source | Human adult brain |
Rouge ID |
mKIAA0275
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3725 bp |
---|---|
Genome contig ID | gi89161187r_73388799 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 73488799 | 73518778 | 11 | 99.0 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011497 | 221 | 266 | PF07648 | Protease inhibitor |
IPR000716 | 399 | 462 | PF00086 | Thyroglobulin type-1 | |
HMMSmart | IPR002350 | 221 | 266 | SM00280 | Proteinase inhibitor I1 |
IPR000716 | 420 | 466 | SM00211 | Thyroglobulin type-1 | |
ProfileScan | IPR000716 | 396 | 462 | PS51162 | Thyroglobulin type-1 |
ScanRegExp | IPR000716 | 419 | 448 | PS00484 | Thyroglobulin type-1 |
Panel name | Genebridge 4 |
---|---|
Primer_f | CTGTGTGCGTGTGCGTTGATG |
Primer_r | GGCAGATAAAGACGACACGAG |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |