| ROUGE |
Gene/Protein Characteristic Table for mKIAA4039 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220280 |
|---|---|
| sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3. testican 3. |
|
| mid20034 [Vector Info] | |
| Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2950 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1471 bp Genome contig ID gi65515060f_61917489 PolyA signal sequence
(AATAAA,-19)
TTATGTATAGTTTACAAATAAAGAATCTTGTAACCFlanking genome sequence
(502627 - 502676)
AAAGTAAACAGTTCCTTAATGATTTTCTTGGGTATACATAATAGCATGAA
Features of the protein sequence |
Description | |
Coding region: 13..1476
Length: 488 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
