Order Kazusa clone(s) from : ![]() |
Product ID | ORK05023 |
---|---|
Accession No | D87464 |
Description | FIG4 phosphoinositide 5-phosphatase |
Clone name | ha06690 |
Vector information | |
cDNA sequence | DNA sequence (3010 bp) Predicted protein sequence (932 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0274
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 162 bp |
---|---|
Genome contig ID | gi89161210f_110019208 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (234116 - 234165) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 110119208 | 110253322 | 23 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TCAGCCCCCAAGAGTAGACAG |
Primer_r | GCGGTTCCTGATGTACTCTCG |
PCR product length | 127 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |