ROUGE |
Gene/Protein Characteristic Table for mKIAA0271 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172925 |
---|---|
Apoptosis regulator Bcl-W. | |
mia06063 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3442 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2861 bp Genome contig ID gi65540054f_49301215 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CGTATTAAAAATAAATAAATAAAGCCCAGAAATTTFlanking genome sequence None
KIAA Alignment based on: KIAA0271 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..581
Length: 192 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |