ROUGE

Gene/Protein Characteristic Table for mKIAA0228

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122222
Description :	amyloid beta precursor protein (cytoplasmic tail) binding protein 2.
Clone Name :	mbg08794 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6060 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4384 bp

Genome contig ID gi65527427r_84815256
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TGACCTAATAAATAGTGTTCCTGCATTCGTAGTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGCTTCCGATTGAATTGTGATTGCTTTGGGTTAGAATTTTGGCTTTTAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0228 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0228	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1676
Length: 557 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9DAX9	100.0	Amyloid protein...	Mus musculus
EDL15760	100.0	amyloid beta pr...	Mus musculus
Q92624	99.1	Amyloid protein...	Homo sapiens
A5HK05	99.3	Amyloid protein...	Rattus norvegicus
XP_001918329	98.9	amyloid beta pr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173327	4.1e-06	25.5	mKIAA2000
AB093256	0.00067	27.9	mKIAA0664

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR001440 401 434 PS50293 TPR repeat

IPR001440 401 434 PS50005 TPR repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001440	401	434	PS50293	TPR repeat
IPR001440	401	434	PS50005	TPR repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4384 bp
Genome contig ID	gi65527427r_84815256
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TGACCTAATAAATAGTGTTCCTGCATTCGTAGTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGCTTCCGATTGAATTGTGATTGCTTTGGGTTAGAATTTTGGCTTTTAG

Gene/Protein Characteristic Table for mKIAA0228

Features of the cloned DNA sequence

Features of the protein sequence