ROUGE

Gene/Protein Characteristic Table for mKIAA0212

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129090
Description :	ER degradation-enhancing alpha-mannosidase-like.
Clone Name :	mpm02229 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5818 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3793 bp

Genome contig ID gi65504368f_109231864
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TTATGAATAATTTTTATTAAAAGATTCTCTTTTTG
Flanking genome sequence
(130676 - 130725)
----+----*----+----*----+----*----+----*----+----*
AGTTGTCACTGTGTTTCTCCTTTGCATGCTCTGCAAGACCAGGGAAAATC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0212 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0212	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2025
Length: 674 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q925U4	100.0	ER degradation-...	Mus musculus
BAE30594	99.8	unnamed protein...	Mus musculus
EDK99415	99.8	ER degradation ...	Mus musculus
XP_238366	99.1	similar to ER d...	Rattus norvegicus
BAF75842	97.4	ER degradation ...	Cricetulus griseus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC060718	1.2e-17	42.0	mKIAA4030

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001382 268 416 PD003239 Glycoside hydrolase

FPrintScan IPR001382 154 174 PR00747 Glycoside hydrolase

IPR001382 200 214 PR00747 Glycoside hydrolase

IPR001382 237 255 PR00747 Glycoside hydrolase

IPR001382 291 310 PR00747 Glycoside hydrolase

IPR001382 383 400 PR00747 Glycoside hydrolase

IPR001382 451 467 PR00747 Glycoside hydrolase

IPR001382 506 530 PR00747 Glycoside hydrolase

IPR001382 565 585 PR00747 Glycoside hydrolase

HMMPfam IPR001382 154 603 PF01532 Glycoside hydrolase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001382	268	416	PD003239	Glycoside hydrolase
FPrintScan	IPR001382	154	174	PR00747	Glycoside hydrolase
IPR001382	200	214	PR00747	Glycoside hydrolase
IPR001382	237	255	PR00747	Glycoside hydrolase
IPR001382	291	310	PR00747	Glycoside hydrolase
IPR001382	383	400	PR00747	Glycoside hydrolase
IPR001382	451	467	PR00747	Glycoside hydrolase
IPR001382	506	530	PR00747	Glycoside hydrolase
IPR001382	565	585	PR00747	Glycoside hydrolase
HMMPfam	IPR001382	154	603	PF01532	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 28 50 LVLGLVLLRLGLHAVLWLVFGLG

Method	From	To	amino acid sequence
SOSUI	28	50	LVLGLVLLRLGLHAVLWLVFGLG

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3793 bp
Genome contig ID	gi65504368f_109231864
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTATGAATAATTTTTATTAAAAGATTCTCTTTTTG
Flanking genome sequence (130676 - 130725)	----+--------+--------+--------+--------+----* AGTTGTCACTGTGTTTCTCCTTTGCATGCTCTGCAAGACCAGGGAAAATC

Gene/Protein Characteristic Table for mKIAA0212

Features of the cloned DNA sequence

Features of the protein sequence