ROUGE

Gene/Protein Characteristic Table for mKIAA4030

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC060718
Description :
Clone Name :	mbg21384 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5384 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3336 bp

Genome contig ID gi65488608f_151542388
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TACTGATTGTAAATTTAATAAAACATGTAAATATT
Flanking genome sequence
(136955 - 137004)
----+----*----+----*----+----*----+----*----+----*
CTGGTCTAGTTTTAAATTTCAAATTTTTAGAATCATTGTACAAATATCTA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3..2045
Length: 681 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH60718	100.0	Edem3 protein [...	Mus musculus
AAI38659	100.0	ER degradation ...	Mus musculus
Q2HXL6	99.9	ER degradation-...	Mus musculus
XP_222721	96.2	similar to Puta...	Rattus norvegicus
XP_001490935	94.7	ER degradation ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129090	5e-20	42.0	mKIAA0212

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001382 1 59 PD003239 Glycoside hydrolase

HMMPfam IPR001382 1 249 PF01532 Glycoside hydrolase

IPR003137 425 530 PF02225 Protease-associated PA

ProfileScan IPR003137 434 537 PS50840 Protease-associated PA

ScanRegExp IPR000886 678 681 PS00014 Endoplasmic reticulum targeting sequence

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001382	1	59	PD003239	Glycoside hydrolase
HMMPfam	IPR001382	1	249	PF01532	Glycoside hydrolase
IPR003137	425	530	PF02225	Protease-associated PA
ProfileScan	IPR003137	434	537	PS50840	Protease-associated PA
ScanRegExp	IPR000886	678	681	PS00014	Endoplasmic reticulum targeting sequence

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3336 bp
Genome contig ID	gi65488608f_151542388
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TACTGATTGTAAATTTAATAAAACATGTAAATATT
Flanking genome sequence (136955 - 137004)	----+--------+--------+--------+--------+----* CTGGTCTAGTTTTAAATTTCAAATTTTTAGAATCATTGTACAAATATCTA

Gene/Protein Characteristic Table for mKIAA4030

Features of the cloned DNA sequence

Features of the protein sequence