ROUGE |
Gene/Protein Characteristic Table for mKIAA4030 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC060718 |
---|---|
mbg21384 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5384 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3336 bp Genome contig ID gi65488608f_151542388 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TACTGATTGTAAATTTAATAAAACATGTAAATATTFlanking genome sequence
(136955 - 137004) ----+----*----+----*----+----*----+----*----+----*
CTGGTCTAGTTTTAAATTTCAAATTTTTAGAATCATTGTACAAATATCTA
Features of the protein sequence |
Description | |
Coding region: 3..2045
Length: 681 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |